pydna.crispr
Provides the Dseq class for handling double stranded DNA sequences.
Dseq is a subclass of Bio.Seq.Seq. The Dseq class
is mostly useful as a part of the pydna.dseqrecord.Dseqrecord class
which can hold more meta data.
The Dseq class support the notion of circular and linear DNA topology.
- class pydna.crispr.cas9(protospacer)[source]
Bases:
_casdocstring.
|----size----------| ---protospacer------ -fst3 fst5 |-| |--------------| PAM 5-NNGGAAGAGTAATACACTA-AAANGGNN-3 ||||||||||||||||||| |||||||| 3-NNCCTTCTCATTATGTGAT-TTTNCCNN-5 ||||||||||||||||| ||| 5-GGAAGAGTAATACACTA-AAAg-u-a-a-g-g Scaffold ---gRNA spacer--- u-a u-a u-a u-a a-u g-u-g a a g-c-a c-g u-a a-u g a tetraloop a-a
- scaffold = 'GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGG'
- pam = '.GG'
- size = 20
- fst5 = 17
- fst3 = -3
- ovhg = 0