# How to Model CRISPR-Cas9 Experiments in pydna

> Visit the full library documentation [here](https://pydna-group.github.io/pydna/)

The pydna package can simulate CRISPR-Cas9 editing, which allows one to cut DNA sequences at specific sites using guide RNAs (gRNAs) that direct the Cas9 protein. This page will guide you through the process of using the `pydna.crispr` module to model a CRISPR-Cas9 cut on a DNA sequence.

The `pydna.crispr` module contains the `cas9` class to simulate the biological activites of the Cas9 protein and the guideRNA, which should be imported. In addtion, the `Dseqrecord` class has also been imported to generate an example target_sequence.

<a target="_blank" href="https://colab.research.google.com/github/pydna-group/pydna/blob/master/docs/notebooks/CRISPR.ipynb">
  <img src="https://colab.research.google.com/assets/colab-badge.svg" alt="Open In Colab"/>
</a>


```python
%%capture
# Install pydna (only when running on Colab)
import sys
if 'google.colab' in sys.modules:
    %pip install pydna

```


```python
from pydna.crispr import cas9, protospacer
from pydna.dseqrecord import Dseqrecord
```

The target sequence and guideRNA (gRNA) sequence needs to be generated. Note the the sequence can be passed as a `Dseqrecord` object.


```python
from pydna.dseqrecord import Dseqrecord
from pydna.crispr import cas9, protospacer

#         <----protospacer---><-------scaffold----------------->
guide =  "GTTACTTTACCCGACGTCCCgttttagagctagaaatagcaagttaaaataagg"
target = "GTTACTTTACCCGACGTCCCaGG"
#                             <->
#                             PAM

# Create an enzyme object with the protospacer
enzyme = cas9("GTTACTTTACCCGACGTCCC")

target_dseq = Dseqrecord(target)

# Cut using the enzyme
print('cutting with enzyme 1:', target_dseq.cut(enzyme))


# Get the protospacer from the full gRNA sequence
gRNA_protospacers = protospacer(Dseqrecord(guide), cas=cas9)
# Print the protospacer (it's a list because often plasmids contain multiple gRNAs)
print('protospacer:', gRNA_protospacers[0])
gRNA_protospacer = gRNA_protospacers[0]

# Create an enzyme from the protospacer
enzyme2 = cas9(gRNA_protospacer)

# Simulate the cut
print('cutting with enzyme 2:', target_dseq.cut(enzyme2))


# Note that without the PAM, the cut will not be made.

target_noPAM_dseq = Dseqrecord("GTTACTTTACCCGACGTCCCaaa")
print("cutting with no PAM in target:", target_noPAM_dseq.cut(enzyme2))
```

    cutting with enzyme 1: (Dseqrecord(-17), Dseqrecord(-6))
    protospacer: GTTACTTTACCCGACGTCCC
    cutting with enzyme 2: (Dseqrecord(-17), Dseqrecord(-6))
    cutting with no PAM in target: ()